Chrysanthemum makinoi genome
WebSep 9, 2010 · The interspecific cross between Chrysanthemum × grandiflorum (Ramat.) Tzvel. ‘rm20-12’ (R, 2n = 54) and C. makinoi Matsum., and Nakai (M, 2n = 18) was achieved using embryo rescue, and a single backcross progeny using C. × grandiflorum ‘rm20-12’ as paternal parent was obtained. WebMar 31, 2016 · View Full Report Card. Fawn Creek Township is located in Kansas with a population of 1,618. Fawn Creek Township is in Montgomery County. Living in Fawn …
Chrysanthemum makinoi genome
Did you know?
WebApr 11, 2024 · Analyses of a chromosome-scale genome assembly reveal the origin and evolution of cultivated chrysanthemum - PMC Back to Top Skip to main content An … WebJan 1, 2024 · Europe PMC is an archive of life sciences journal literature.
WebMontgomery County, Kansas. Date Established: February 26, 1867. Date Organized: Location: County Seat: Independence. Origin of Name: In honor of Gen. Richard … WebJan 20, 2024 · The above estimated cost for generating the first human genome sequence by the HGP should not be confused with the total cost of the HGP. The originally …
WebOct 13, 2024 · Chrysanthemum makinoi, chrysanthemum, genome assembly, annotation Introduction As one of the most economically important ornamental crops ( Anderson … WebDive into the research topics of 'De novo whole-genome assembly of Chrysanthemum makinoi, a key wild chrysanthemum'. Together they form a unique fingerprint. Chrysanthemum Medicine & Life Sciences 100%
WebJun 29, 2024 · We thus developed a model strain, Gojo-0 (Chrysanthemum seticuspe), which is31 a diploid and self-compatible pure line. Here, we present the 3.05 Gb chromosome-level reference genome sequence,32 which covered 97% of the C. 33 seticuspe genome.
WebJul 10, 2024 · This genome assembly of C. makinoi provides an important step forward in understanding the chrysanthemum genome, evolution and history. Available via license: CC BY-NC 4.0 Content may be... chisholm and hunter saleWebChrysanthemum makinoi genome assembly, organelle: mitochondrion 6.91E-78 LC649888 R: GTTTCTT CCCGTCACCATACCCTCTAA Tef_25638 F: CGGAGAGCCGAGAGGTG GAAACTGA (ATC)15 264-309 FAM No significant hit LC649889 R: GTTTCTT TCCGTTCTTCTATATGATGGGG Tef_26198 F: … chisholm annual reportWebJan 20, 2024 · This C. lavandulifolium genome is the first chromosome-level genome in the genus Chrysanthemum. The protein-coding genes were annotated by ab initio … graphite rticWebJul 5, 2024 · Chrysanthemum makinoi whole genome sequencing genome assembly Accession numbers PRJEB44800 ERP128891 Access Dataset … graphite ropeWebFeb 13, 2024 · chrysanthemum, (genus Chrysanthemum), genus of about 40 species of flowering plants in the aster family , native primarily to subtropical and temperate areas of the Old World. Chrysanthemums … graphite rope seal installationWebApr 11, 2024 · Despite the economic importance and evolutionary significance of cultivated chrysanthemum, its genome has not yet been deciphered, mainly due to its polyploidy, high repetitiveness, high heterozygosity, and large size. ... et al. De novo whole-genome assembly of Chrysanthemum makinoi, a key wild chrysanthemum. G3. 2024; … chisholm and kilpatrick tdiuWebMagnaporthe grisea, pathogène du riz est cosmopolite et cause d’énormes dégâts au Mali. L’utilisation de variétés résistantes et de fongicides chimiques sont efficaces pour son contrôle, mais présentent des limites objectives avec le contournement des gènes de résistances par l’agent pathogène, ainsi que les risques sanitaires et environnementaux … graphite roughness